circad | circRNAs associated with diseases

circZFR/hsa_circRNA_103809/hsa_circ_10072088
Gene	ZFR	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Liver Cancer	ICD-10	Malignant neoplasm of Liver, unspecified (C22.9)
DBLink	Link to database	PMID	28727484
Experimental Method
Sample Type	Tissues	Comparison	three pairs of liver cancer clinical tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TTTCCAAGCTGGCCCTTACG Reverse ACAAACTGTCTGAAACGAG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Ren, S, Xin, Z, Xu, Y, Xu, J, Wang, G (2017). Construction and analysis of circular RNA molecular regulatory networks in liver cancer. Cell Cycle, 16, 22:2204-2211.